http://rosalind.info/problems/dna/
Create a program called "dna.py" that will accept a sequence of DNA as a single positional argument. The program should print a "usage" statement for "-h" or "--help" flags:
$ ./dna.py -h
usage: dna.py [-h] DNA
Tetranucleotide frequency
positional arguments:
DNA Input DNA sequence
optional arguments:
-h, --help show this help message and exit
The program should print the frequencies of the bases A, C, G, and T:
$ ./dna.py AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
The "make test" target will run the complete test suite:
$ make test
python3 -m pytest -xv --flake8 --pylint --mypy dna.py tests/dna_test.py
============================ test session starts ============================
...
dna.py::FLAKE8 PASSED [ 11%]
dna.py::mypy PASSED [ 22%]
tests/dna_test.py::FLAKE8 SKIPPED [ 33%]
tests/dna_test.py::mypy PASSED [ 44%]
tests/dna_test.py::test_exists PASSED [ 55%]
tests/dna_test.py::test_usage PASSED [ 66%]
tests/dna_test.py::test_arg PASSED [ 77%]
tests/dna_test.py::test_file PASSED [ 88%]
::mypy PASSED [100%]
=================================== mypy ====================================
Success: no issues found in 2 source files
======================= 8 passed, 1 skipped in 0.87s ========================
Ken Youens-Clark [email protected]