# 15 August 2019  Stacia K. Wyman [email protected]

BLENDER DEMO

This DEMO directory contains data for running BLENDER on a single chromosome (chr19) 
for DISCOVER-Seq from MRE11 ChIP-Seq of the VEGFA site 2 guide in K562 cells.
This will produce the output (for chr19) based on "Unbiased detection of CRISPR 
off-targets in vivo using DISCOVER-Seq" Science (2019) and found in Figure 4 of 
"CRISPR off-target detection with DISCOVER-Seq", Nature Protocols (2019).

Bam files for the IP file and the control file (BFP ChIP) are provided in the bwa
directory and expected output can be found in the expected_output directory. Chromosome 19 
has three off-target hits.

To run BLENDER on the demo data, use the following command in the main blender directory:

sh run_blender.sh <path/to/reference/genome> \
    DEMO/bwa/BW43_VEFGA.chr19.bam \
    DEMO/bwa/BW44_BFP_control.chr19.bam \
    GACCCCCTCCACCCCGCCTC DEMO/blender

This will take approximately a minute or less to run, and the three output files can be found 
in the DEMO/blender directory. 

The fastq files to run this data on all chromosomes can be found in the NCBI Short Read Archive 
with BioProject Accession PRJNA509652. The links to the fastq files are (click on "Data Access" 
tab to get fastq download):

VEGFA IP Fastqs (BW43): https://trace.ncbi.nlm.nih.gov/Traces/sra/?run=SRR8550675
BFP control fastqs (BW44): https://trace.ncbi.nlm.nih.gov/Traces/sra/?run=SRR8550676

Bam files for the data will be available in the near future on the BioProject.