amphipathic

This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.

Requirements

If you want to use this library on any GNU/Linux or OSX system you just need to execute:

$ pip install amphipathic

If you want to collaborate with this library, you should download the github repository and execute:

$ make deploy

Testing

To test all the project you should use the command:

$ make test

Example

This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective index:

import amphipathic
resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS') 
print resume

And the result should be:

[[
    {'end': 2,
     'begin': 0,
     'type': u'c',
     'seq': 'nl',
     'amphipathic': {'index': 7.572935321054872e-05, 'mean': 2.6}},
    {'end': 5,
     'begin': 2,
     'type': u'e',
     'seq': 'yiq',
     'amphipathic': {'index': 1.4312912272216411, 'mean': 1.7299999999999998}},
    {'end': 18,
     'begin': 5,
     'type': u'c',
     'seq': 'wlkdggpssgrpp',
     'amphipathic': {'index': 0.002511560979331271, 'mean': -0.43}},
    {'end': 20,
     'begin': 18,
     'type': u'e',
     'seq': 'ps',
     'amphipathic': {'index': 1.6242872515167746, 'mean': -1.34}}
]]

It also accept a nucleotide sequence to perform the same analysis:

import amphipathic
resume = amphipathic.index('cgcgtccttggagcaatgcagttcaagaccaagaatcgaattgaacctgt') 
print resume

And the output:

[[
    {'end': 12,
     'begin': 0,
     'type': u'c',
     'seq': 'rvlgamqfktkn',
     'amphipathic': {'index': 0.007560225956225585, 'mean': 0.7825000000000001}},
    {'end': 15,
     'begin': 12,
     'type': u'e',
     'seq': 'rie',
     'amphipathic': {'index': 1.6297837670649824, 'mean': 1.4599999999999997}},
    {'end': 16,
     'begin': 15,
     'type': u'c',
     'seq': 'p',
     'amphipathic': {'index': 0.0, 'mean': -2.23}}
]]

Last, it also accept a polyprotein sequence. When working with aminoacid it detect the '*' character as a stop signal:

import amphipathic
resume = amphipathic.index('NLYIQWLKDG*GPSSGRPPPS') 
print resume

Questions?

If you want to develope with us or have questions about this library, please file an issue in this repository so some of the project managers can get back to you. Please check the existing (and closed) issues to make sure your issue hasn't already been addressed.