_writing_using_seqtk.rst

This guide is going to demonstrate building up tools for commands from Heng Li's Seqtk package - a package for processing sequence data in FASTA and FASTQ files.

To get started let's install Seqtk. Here we are going to use conda to install Seqtk - but however you obtain it should be fine.

$ conda install --force --yes -c bioconda seqtk=1.2
    ... seqtk installation ...
$ seqtk seq
        Usage:   seqtk seq [options] <in.fq>|<in.fa>
        Options: -q INT    mask bases with quality lower than INT [0]
                 -X INT    mask bases with quality higher than INT [255]
                 -n CHAR   masked bases converted to CHAR; 0 for lowercase [0]
                 -l INT    number of residues per line; 0 for 2^32-1 [0]
                 -Q INT    quality shift: ASCII-INT gives base quality [33]
                 -s INT    random seed (effective with -f) [11]
                 -f FLOAT  sample FLOAT fraction of sequences [1]
                 -M FILE   mask regions in BED or name list FILE [null]
                 -L INT    drop sequences with length shorter than INT [0]
                 -c        mask complement region (effective with -M)
                 -r        reverse complement
                 -A        force FASTA output (discard quality)
                 -C        drop comments at the header lines
                 -N        drop sequences containing ambiguous bases
                 -1        output the 2n-1 reads only
                 -2        output the 2n reads only
                 -V        shift quality by '(-Q) - 33'

Next we will download an example FASTQ file and test out the a simple Seqtk command - seq which converts FASTQ files into FASTA.

$ wget https://raw.githubusercontent.com/galaxyproject/galaxy-test-data/master/2.fastq
$ seqtk seq -A 2.fastq > 2.fasta
$ cat 2.fasta
>EAS54_6_R1_2_1_413_324
CCCTTCTTGTCTTCAGCGTTTCTCC
>EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
>EAS54_6_R1_2_1_443_348
GTTGCTTCTGGCGTGGGTGGGGGGG