Skip to content
/ Unicycler Public
forked from rrwick/Unicycler

hybrid assembly pipeline for bacterial genomes

License

Notifications You must be signed in to change notification settings

mr-c/Unicycler

Repository files navigation

Unicycler

Unicycler is a hybrid assembly pipeline for bacterial genomes. It uses both Illumina reads and long reads (PacBio or Nanopore) to produce complete and accurate assemblies.

Table of contents

Introduction

As input, Unicycler takes a good set of Illumina reads from a bacterial isolate (required) and long reads from the same isolate (optional). If the input is sufficient, it will produce a completed assembly of circularised sequences.

Reasons to use Unicycler:

  • It has very low misassembly rates.
  • It can cope with very repetitive genomes, such as Shigella.
  • It correctly handles plasmids of varying depth.
  • It works with long reads of any quality – even Nanopore reads classed as 'fail' can be used as input.
  • It works with any long read depth. 10x or more may be required to complete a genome, but Unicycler can make nearly-complete genomes with far fewer long reads.
  • Even if you have no long reads, it functions as a SPAdes optimiser and produces very good Illumina assemblies.
  • It produces an assembly graph in addition to a contigs FASTA file, viewable in Bandage.
  • It's easy to use, runs with just one command and doesn't require tinkering with parameters!

Reasons to not use Unicycler:

  • You only have long reads, not Illumina reads (try Canu instead).
  • Your Illumina reads are poor quality (Unicycler requires a good short read assembly graph – more info here).
  • You're assembling a large eukaryotic genome or a metagenome (Unicycler is designed for small genomes like bacterial isolates).
  • Your Illumina reads and long reads are from different isolates.
  • You're very impatient (Unicycler is not as fast as alternatives).

Requirements

  • Linux or macOS
  • Python 3.4 or later
  • C++ compiler
    • GCC, Clang and ICC should all work if the version isn't too old (C++11 support is required).
  • SPAdes 3.6.2 or later

Unicycler needs the following tools for certain parts of its pipeline. They are optional, but without them Unicycler will not be able to perform all tasks:

  • Pilon (required for polishing)
  • Java (required for polishing)
  • Bowtie2 (required for polishing)
  • Samtools version 1.0 or later (required for polishing)
  • BLAST+ (required for rotating finished assemblies)

Bandage isn't required to run Unicycler, but it is very helpful for manually investigating assemblies (the graph images in this README were made with Bandage). Make sure to get the latest release for full compatibility with Unicycler.

Installation

Typical installation

git clone https://github.com/rrwick/Unicycler.git
cd Unicycler
python3 setup.py install

If the last command complains about permissions, you may need to run it with sudo.

Other installation commands

  • Install just for your user: python3 setup.py install --user
    • If you get a strange 'can't combine user with prefix' error, read this.
  • Install to a specific location: python3 setup.py install --prefix=$HOME/.local
  • Install with pip (local copy): pip3 install path/to/Unicycler
  • Install with pip (from GitHub): pip3 install git+https://github.com/rrwick/Unicycler.git
  • Install with specific Makefile options: python3 setup.py install --makeargs "CXX=icpc"
  • Build and run without installing:
    • Run make in the Unicycler directory.
    • Then you can execute path/to/unicycler-runner.py instead of unicycler

Quick usage

These commands use the reads you'll find in the sample_data directory. They are synthetic reads generated from plasmids in a Shigella sonnei reference.

Short read-only assembly:
unicycler -1 short_reads_1.fastq.gz -2 short_reads_2.fastq.gz -o output_dir

Hybrid assembly:
unicycler -1 short_reads_1.fastq.gz -2 short_reads_2.fastq.gz -l long_reads_high_depth.fastq.gz -o output_dir

How it works

Assembly graphs

To understand what Unicycler is doing, you need to know about assembly graphs. For a thorough introduction, I'd suggest this tutorial or the Velvet paper. But in short, an assembly graph is a data structure where contigs aren't disconnected sequences but can have connections to each other:

Just contigs:               Assembly graph:

TCGAAACTTGACGCGAGTCGC                             CTTGTTTA
TGCTACTGCTTGATGATGCGG                            /        \
TGTCCATT                    TCGAAACTTGACGCGAGTCGC          TGCTACTGCTTGATGATGCGG
CTTGTTTA                                         \        /
                                                  TGTCCATT

Most assemblers use graphs internally to produce their assemblies, but users often ignore the graph in favour of the conceptually simpler FASTA file of contigs. When a genome assembly is 100% complete, we have one contig per chromosome/plasmid and there's no real need for the graph. But most assemblies are not complete (especially short read assemblies), and a graph can describe an incomplete assembly much better than contigs alone.

Limitations of short reads

The main reason we can't get a complete assembly from short reads is that DNA usually contains repeats – the same sequence occuring two or more times in the genome. When a repeat is longer than the reads (or for paired-end sequencing, longer than the insert size), it forms a single contig in the assembly graph with multiple connections in and multiple connections out.

Here is what happens to a simple bacterial assembly graph as you add repeats to the genome:

Repeats in graph

As repeats are added, the graph becomes increasingly tangled (and real assembly graphs get a lot more tangled than that).

To complete a bacterial genome assembly (i.e. find the one correct sequence for each chromosome/plasmid), we need to resolve the repeats. This means finding which way into a repeat matches up with which way out. Short reads don't have enough information for this but long reads do.

SPAdes graphs

Assembly graphs come in many different varieties, but we are particularly interested in the kind produced by SPAdes, because that is what Unicycler uses.

SPAdes graphs are made by performing a De Bruijn graph assembly with a range of different k-mer sizes, from small to large (see the SPAdes paper). Each assembly builds on the previous one, which allows SPAdes to get the advantages of both small k-mer assemblies (a more connected graph) and large k-mer assemblies (ability to resolve repeats). As a consequence of how SPAdes combines k-mers, two contigs in a SPAdes graph that connect will overlap by their k-mer size (more info on the Bandage wiki page).

After producing the graph, SPAdes can perform further repeat resolution by using paired-end information. Since two reads in a pair are close to each other in the original DNA, SPAdes can use this to trace paths in the graph to form larger contigs (see their paper on ExSPAnder). However, the SPAdes contigs with repeat resolution do not come in graph form – they are only available in a FASTA file.

Unicycler pipeline in brief

Unicycler uses SPAdes to get an assembly graph made from Illumina reads. Since Illumina reads are accurate, this graph has very few mistakes. But since Illumina reads are short, it will also contain unresolved repeats. Unicycler then uses the SPAdes repeat resolution and long read alignments to build 'bridges' between non-repeat contigs, simplifying the graph into fewer, longer contigs.

Essentially, Unicycler is a scaffolder which uses long reads to properly arrange Illumina contigs. But unlike a naive scaffolding tool which operates on assembled contigs, Unicycler works on an assembly graph. This gives it much more information to complete assemblies and a lower risk of mistakes.

Here is the process in a bit more detail:

1. Read correction

Unicycler uses SPAdes' built-in read correction step before assembling the Illumina reads. This can be disabled with --no_correct if your Illumina reads are very high quality or you've already performed read QC.

2. SPAdes assembly

Unicycler uses SPAdes to assemble the Illumina reads into an assembly graph. It tries assemblies at a wide range of k-mer sizes, evaluating the graph at each one. It chooses the graph which best minimises both contig count and dead end count. If the Illumina reads are good, it produces an assembly graph with long contigs but few to no dead ends (more info here). Since a typical bacterial genome has no dead ends (the sequences are circular) an ideal assembly graph won't either.

A raw SPAdes graph can also contain some 'junk' sequences due to sequencer artefacts or contamination, so Unicycler performs some graph cleaning to remove these. Therefore, small amounts of contamination in the Illumina reads should not be a problem.

3. Multiplicity

In order to scaffold the graph, Unicycler must distinguish between single-copy contigs and repeats. It does this with a greedy algorithm that uses both read depth and graph connectivity:

Multiplicity assignment

This process does not assume that all single-copy contigs have the same read depth, which allows it to identify single-copy contigs from plasmids as well as the chromosome.

4. Short read bridging

At this point, the assembly graph does not contain the SPAdes repeat resolution. To apply this to the graph, Unicycler builds bridges between single-copy contigs using the information in the SPAdes contigs.paths file. These are applied to the graph to make the spades_bridges_applied.gfa output – the most resolved graph Unicycler can make using only the Illumina reads.

Short read bridging

5. Long read bridging

Long reads are the most useful source of information for resolving the assembly graph, so Unicycler semi-globally aligns them to the contigs (see Unicycler align for more information). For each pair of single-copy contigs which are linked by read alignments, Unicycler uses the read consensus sequence to find a connecting path and creates a bridge.

Long read bridging

6. Bridge application

At this point of the pipeline there can be many bridges, some of which may conflict. Unicycler therefore assigns a quality score to each based on all available evidence (e.g. read alignment quality, graph path match, read depth consistency). Bridges are then applied in order of decreasing quality so whenever there is a conflict, only the most supported bridge is used. A minimum quality threshold prevents the application of low evidence bridges (see Conservative, normal and bold for more information).

Application of bridges

7. Finalisation

If the above steps have resulted in any simple, circular sequences, then Unicycler will attempt to rotate/flip them to begin at a consistent starting gene. By default this is dnaA or repA, but users can specify their own with the --start_genes option.

Finally, Unicycler does a single pass of short read polishing using Pilon. For a more extensive polishing process, see the section on Unicycler polish

Conservative, normal and bold

Unicycler can be run in three modes: conservative, normal (the default) and bold, set with the --mode option. Conservative mode is least likely to produce a complete assembly but has a very low risk of misassembly. Bold mode is most likely to produce a complete assembly but carries greater risk of misassembly. Normal mode is intermediate regarding both completeness and misassembly risk.

If the structural accuracy of your assembly is paramount to your research, conservative mode is recommended. If you want a completed genome, even if it contains a mistake or two, then use bold mode.

The specific differences between the three modes are as follows:

Mode Invocation Short read bridges Bridge quality threshold Contig merging
conservative ‑‑mode conservative not used high (25) contigs are only merged with bridges
normal ‑‑mode normal
(or nothing)
used medium (10) contigs are merged with bridges and when their multiplicity is 1
bold ‑‑mode bold used low (1) contigs are merged wherever possible

Conservative, normal and bold

In the above example, the conservative assembly is incomplete because some bridges fell below the quality threshold and were not applied. Its contigs, however, are extremely reliable. Normal mode nearly gave a complete assembly, but a couple of unmerged contigs remain. Bold mode completed the assembly, but since lower confidence regions were bridged and merged, there is a larger risk of error.

Options and usage

Standard options

Run unicycler --help to view the program's most commonly used options:

usage: unicycler [-h] [--help_all] [--version] -1 SHORT1 -2 SHORT2 [-l LONG] -o OUT [--verbosity VERBOSITY] [--keep_temp KEEP_TEMP] [-t THREADS]
                 [--mode {conservative,normal,bold}] [--expected_linear_seqs EXPECTED_LINEAR_SEQS]

       __
       \ \___
        \ ___\
        //
   ____//      _    _         _                     _
 //_  //\\    | |  | |       |_|                   | |
//  \//  \\   | |  | | _ __   _   ___  _   _   ___ | |  ___  _ __
||  (O)  ||   | |  | || '_ \ | | / __|| | | | / __|| | / _ \| '__|
\\    \_ //   | |__| || | | || || (__ | |_| || (__ | ||  __/| |
 \\_____//     \____/ |_| |_||_| \___| \__, | \___||_| \___||_|
                                        __/ |
                                       |___/

Unicycler: a hybrid assembly pipeline for bacterial genomes

Help:
  -h, --help                            Show this help message and exit
  --help_all                            Show a help message with all program options
  --version                             Show Unicycler's version number

Input:
  -1 SHORT1, --short1 SHORT1            FASTQ file of short reads (first reads in each pair)
  -2 SHORT2, --short2 SHORT2            FASTQ file of short reads (second reads in each pair)
  -s UNPAIRED, --unpaired UNPAIRED      FASTQ file of unpaired short reads
  -l LONG, --long LONG                  FASTQ or FASTA file of long reads, if all reads are available at start.

Output:
  -o OUT, --out OUT                     Output directory
  --verbosity VERBOSITY                 Level of stdout information (0 to 3, default: 1)
                                          0 = no stdout, 1 = basic progress indicators, 2 = extra info, 3 = debugging info
  --min_fasta_length MIN_FASTA_LENGTH   Exclude contigs from the FASTA file which are shorter than this length (default: 1)
  --keep_temp KEEP_TEMP                 Level of file retention (0 to 2, default: 0)
                                          0 = only keep files at main checkpoints, 1 = keep some temp files including SAM, 2 = keep all temp files

Other:
  -t THREADS, --threads THREADS         Number of threads used (default: number of CPUs, up to 8)
  --mode {conservative,normal,bold}     Bridging mode (default: normal)
                                          conservative = smaller contigs, lowest misassembly rate
                                          normal = moderate contig size and misassembly rate
                                          bold = longest contigs, higher misassembly rate
  --expected_linear_seqs EXPECTED_LINEAR_SEQS
                                        The expected number of linear (i.e. non-circular) sequences in the underlying sequence

Advanced options

Run unicycler --help_all to see a complete list of the program's options. These allow you to turn off parts of the pipeline, specify the location of tools (only necessary if they are not in PATH) and adjust various settings:

SPAdes assembly:
  These options control the short read SPAdes assembly at the beginning of the Unicycler pipeline.

  --spades_path SPADES_PATH             Path to the SPAdes executable
  --no_correct                          Skip SPAdes error correction step
  --min_kmer_frac MIN_KMER_FRAC         Lowest k-mer size for SPAdes assembly, expressed as a fraction of the read length
  --max_kmer_frac MAX_KMER_FRAC         Highest k-mer size for SPAdes assembly, expressed as a fraction of the read length
  --kmer_count KMER_COUNT               Number of k-mer steps to use in SPAdes assembly

Assembly rotation:
  These options control the rotation of completed circular sequence near the end of the Unicycler pipeline.

  --no_rotate                           Do not rotate completed replicons to start at a standard gene
  --start_genes START_GENES             FASTA file of genes for start point of rotated replicons
  --start_gene_id START_GENE_ID         The minimum required BLAST percent identity for a start gene search
  --start_gene_cov START_GENE_COV       The minimum required BLAST percent coverage for a start gene search
  --makeblastdb_path MAKEBLASTDB_PATH   Path to the makeblastdb executable
  --tblastn_path TBLASTN_PATH           Path to the tblastn executable

Pilon polishing:
  These options control the final assembly polish using Pilon at the end of the Unicycler pipeline.

  --no_pilon                            Do not use Pilon to polish the final assembly
  --bowtie2_path BOWTIE2_PATH           Path to the bowtie2 executable
  --bowtie2_build_path BOWTIE2_BUILD_PATH
                                        Path to the bowtie2_build executable
  --samtools_path SAMTOOLS_PATH         Path to the samtools executable
  --pilon_path PILON_PATH               Path to a Pilon executable or the Pilon Java archive file
  --java_path JAVA_PATH                 Path to the java executable
  --min_polish_size MIN_POLISH_SIZE     Sequences shorter than this value will not be polished using Pilon

Graph cleaning:
  These options control the removal of small leftover sequences after bridging is complete.

  --min_component_size MIN_COMPONENT_SIZE
                                        Unbridged graph components smaller than this size will be removed from the final graph
  --min_dead_end_size MIN_DEAD_END_SIZE
                                        Graph dead ends smaller than this size will be removed from the final graph

Long read alignment:
  These options control the alignment of long reads to the assembly graph.

  --temp_dir TEMP_DIR                   Temp directory for working files ("PID" will be replaced with the process ID)
  --contamination CONTAMINATION         FASTA file of known contamination in long reads, e.g. lambda phage spike-in (default: none).
  --scores SCORES                       Comma-delimited string of alignment scores: match, mismatch, gap open, gap extend
  --low_score LOW_SCORE                 Score threshold - alignments below this are considered poor (default: set threshold automatically)
  --min_len MIN_LEN                     Minimum alignment length (bp) - exclude alignments shorter than this length
  --keep_bad                            Include alignments in the results even if they are below the low score threshold (default: low-scoring alignments are discarded)
  --allowed_overlap ALLOWED_OVERLAP     Allow this much overlap between alignments in a single read
  --kmer KMER                           K-mer size used for seeding alignments

Output files

Depending on the input files and the value used for --keep_temp, Unicycler may only produce some of these. Also, all outputs except for assembly.gfa and assembly.fasta will be prefixed with a number so they are in chronological order.

File Description
unbridged_graph.gfa short read assembly graph before any bridges have been applied
spades_bridges_applied.gfa SPAdes bridges applied, before any cleaning or merging
cleaned.gfa redundant contigs removed from the graph
merged.gfa contigs merged together where possible
long_read_bridges_applied.gfa Long read bridges applied, before any cleaning or merging
cleaned.gfa redundant contigs removed from the graph
merged.gfa contigs merged together where possible
final_clean.gfa more redundant contigs removed
rotated.gfa circular replicons rotated and/or flipped to a start position
polished.gfa after a round of Pilon polishing
assembly.gfa the final assembly in graph format
assembly.fasta the final assembly in FASTA format (same contigs and names as in assembly.gfa)

Tips

Running time

Unicycler is thorough and accurate, but not particularly fast. In particular, the long read bridging step of the pipeline can take a while to complete. Two main factors influence the running time: the number of long reads (more reads take longer to align) and the genome size/complexity (finding bridge paths is more difficult in complex graphs).

Unicycler may only take an hour or so to assemble a small, simple genome with low depth long reads. On the other hand, a complex genome with many long reads may take 12 hours to finish or more. If you have a very high depth of long reads, you can make Unicycler run faster by subsampling for only the longest reads.

Using a lot of threads (with the --threads option) can make Unicycler run faster too. It will only use up to 8 threads by default, but if you're running it on a big machine with lots of CPU and RAM, then feel free to use more!

Necessary read length

The length of a long read is very important, typically more than its accuracy, because longer reads are more likely to align to multiple single-copy contigs, allowing Unicycler to build bridges.

Consider a sequence with a 2 kb repeat:

Long read length

In order to resolve the repeat, a read must span it by aligning to some sequence on either side. In this example, the 1 kb reads are shorter than the repeat and are useless. The 2.5 kb reads can resolve the repeat, but they have to be in just the right place to do so. Only one out of the six in this example is useful. The 5 kb reads, however, have a much easier time spanning the repeat and all three are useful.

So how long must your reads be for Unicycler to complete an assembly? Longer than the longest repeat in the genome. Depending on the genome, that might be a 1 kb insertion sequence, a 6 kb rRNA operon or a 50 kb prophage. If your reads are just a bit longer than the longest repeat, you'll probably need a lot of them. If they are much longer, then fewer reads should suffice. But in any scenario, longer is better!

Poretools

Poretools can turn your Nanopore FAST5 reads into a FASTQ file appropriate for Unicycler. Here's an example command:

poretools fastq --type best --min-length 1000 path/to/fast5/dir/ > nanopore_reads.fastq

If you have 2D reads, --type best makes Poretools give only one FASTQ read per FAST5 file (if you have 1D reads, you can exclude that option). Adjust the --min-length 1000 parameter to suit your dataset – a larger value would be appropriate if you have lots of long reads.

Nanopore: 1D vs 2D

Since Unicycler can tolerate low accuracy reads, Oxford Nanopore 1D sequencing is probably preferable to 2D, as it can provide twice as many reads. However, at the time of writing, the 2D library prep supports barcoding. So if you want to sequence multiple samples on a single flow cell, 2D is currently the only option.

Bad Illumina reads

Unicycler needs decent Illumina reads as input – ideally with uniform read depth and 100% genome coverage.

You can look at the unbridged_graph.gfa file (the first graph Unicycler saves to file) in Bandage to get a quick impression of the Illumina read quality:

Graphs of varying quality

A is an very good Illumina read graph – the contigs are long and there are no dead ends. This read set is ideally suited for use in Unicycler.

B is also a good graph. The genome is more complex, resulting in a more tangled structure, but there are still very few dead ends (you can see one in the lower left). This read set would also work well in Unicycler.

C is a disaster! It is broken into many pieces, probably because parts of the genome got no read depth at all. While you can still use Unicycler to resolve this assembly with long reads, the risk of small errors and misassemblies is considerably higher.

Very short contigs

Confused by very small (e.g. 2 bp) contigs in Unicycler assemblies? Unlike a SPAdes graph where neighbouring sequences overlap by their k-mer size, Unicycler's final graph has no overlaps and the sequences adjoin directly. This means that contigs in complex regions can be quite short. They may be useless as stand-alone contigs but are still important in the graph structure.

Short contigs in assembly graph

If short contigs are a problem for your downstream analysis, you can use the --min_fasta_length to exclude them from Unicycler's FASTA file (they will still be included in the GFA file).

Chromosomes and plasmid depth

Unicycler normalises the depth of contigs in the graph to the median value. This typically means that the chromosome has a depth near 1x and plasmids may have different (typically higher) depths.

Plasmid depths

In the above graph, the chromosome is at the top (you can only see part of it) and there are two plasmids. The plasmid on the left occurs in approximately 4 or 5 copies per cell. For the larger plasmid on the right, most cells probably had one copy but some had more. Since sequencing biases can affect read depth, these per cell counts should be interpreted loosely.

Known contamination

If your long reads have known contamination, you can use the --contamination option to give Unicycler a FASTA file of the contaminant sequences. Unicycler will then discard any reads for which the best alignment is to the contaminant.

For example, if you've sequenced two isolates in succession on the same Nanopore flow cell, there may be residual reads from the first sample in the second run. In this case, you can supply a reference/assembly of the first sample to Unicycler when assembling the second sample.

Some Oxford Nanopore kits include a lambda phage spike-in as a control. Since this is a common contaminant, you can simply use --contamination lambda to filter these out (no need to supply a FASTA file).

Unicycler align

Unicycler's algorithm for sensitive semi-global alignment is available as a stand-alone alignment tool with the command unicycler_align.

Semi-global alignment

Semi-global alignment (a.k.a. glocal, overlap or free end-gap alignment) will not clip an alignment until one of the two sequences ends. This can be where one sequence is contained within the other or where the two sequences overlap:

  TAGAA        GTGCCGGAACA         GGCCACAC     AGTAAGAT
  |||||          |||||||           |||||           |||||
ACTAGAACG        GCCGGAA       GGCTGGCCA           AAGATCTTG

In contrast, local alignment will align only the best matching parts, clipping the alignment where the quality becomes poor:

      CGAACAGCATACTTG
          ||||||||
ACGTCAGACTCAGCATACGCATCTAGA

Semi-global alignment is appropriate when there are no structural differences between the query and reference sequences. For example, when you have a short read assembly graph and long reads from the same bacterial isolate (as is the case in the Unicycler pipeline). In this scenario, there may be small scale differences (due to read errors) but no large scale differences, and semi-global alignment is ideal.

Versus local alignment

Semi-global alignment is probably not appropriate for mapping reads to a more distant reference genome. It does not cope with points of structural variation between the sample and the reference. For example, if the sample had a deletion relative to the reference, a read spanning that deletion would align poorly with semi-global alignment:

read:            AACACTAAACTTAGTCCCAA
                 |||||||||||  |   | |    
reference: GATCCCAACACTAAACTCTGGGGCGAACGGCGTAGTCCCAAGAGT

Local alignment (which can align only part of the read) would be more appropriate:

read:            AACACTAAACT               TAGTCCCAA
                 |||||||||||               |||||||||
reference: GATCCCAACACTAAACTCTGGGGCGAACGGCGTAGTCCCAAGAGT

Try BWA-MEM, LAST or BLASR if you need a local alignment tool.

Example commands

Regular alignment:
unicycler_align --reads queries.fastq --ref target.fasta --sam output.sam

Very sensitive (and slow) alignment:
unicycler_align --reads queries.fastq --ref target.fasta --sam output.sam --sensitivity_level 3

Setting some additional thresholds:
unicycler_align --reads queries.fastq --ref target.fasta --sam output.sam --min_len 1000 --low_score 80.0

Unicycler polish

Unicycler polish is a script to repeatedly polish a completed assembly using all available reads. It can be given Illumina reads, long reads or (ideally) both. When both Illumina and long reads are available, Unicycler polish can fix assembly errors, even in repetitive parts of the genome which cannot be polished by short reads alone.

Requirements

Process

Unicycler polish uses an exhaustive iterative process that is time-consuming but can be necessary to resolve the sequence in repeat regions. For example, consider a genome with two very similar regions, A and B, and there are assembly errors in both. Polishing is initially difficult because the errors may cause reads which should map to A to instead map to B and vice versa. However, after some of these errors are fixed, more reads will map to their correct locations, allowing for more errors to be fixes, allowing more reads to map correctly, etc.

  1. If Illumina reads are available:
    1. Run Pilon in 'bases' mode (substitutions and small indels). If any changes were suggested, apply them and repeat this step.
    2. Run Pilon in 'local' mode (larger variants), and assess each change with ALE. If any variant improves the ALE score, apply it and go back to step 1-i.
  2. If long reads are available:
    1. Run GenomicConsensus/Nanopolish and gather all suggested small changes.
    2. Use FreeBayes to assess each long read-suggested change by looking for ambiguity in the Illumina read mapping. If any were found, apply them and go back to step 2-i.
  3. If Illumina reads are available:
    1. Execute step 1 again.
    2. Run Pilon/GenomicConsensus/Nanopolish again (all that apply) and assess each suggested variant with ALE. If any improves the ALE score, apply it and repeat this step.

Example commands

Polishing with only Illumina reads:
unicycler_polish -1 short_reads_1.fastq.gz -2 short_reads_2.fastq.gz -a assembly.fasta

Polishing with only PacBio reads:
unicycler_polish --pb_bax path/to/*bax.h5 -a assembly.fasta

Hybrid read set (Illumina and PacBio) polishing:
unicycler_polish -1 short_reads_1.fastq.gz -2 short_reads_2.fastq.gz --pb_bax path/to/*bax.h5 -a assembly.fasta

Citation

Paper in progress... check back soon!

Acknowledgements

Unicycler would not have been possible without Kat Holt, my fellow researchers in her lab and the many other people I work with at the University of Melbourne's Centre for Systems Genomics. In particular, Margaret Lam, Kelly Wyres and David Edwards worked with me on many challenging genomes during Unicycler's development.

Unicycler uses Seqan to perform alignments and other sequence manipulations. The authors of this library have been very helpful during Unicycler's development and I owe them a great deal of thanks! It also uses minimap to seed alignments and so I'd like to thank Heng Li for writing such a fast long read aligner.

License

GNU General Public License, version 3

About

hybrid assembly pipeline for bacterial genomes

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Languages

  • C++ 89.9%
  • Python 5.6%
  • C 4.5%