updating READMEs

AyaGold · Jan 30, 2021 · f3fd009 · f3fd009
1 parent 1d16280
commit f3fd009
Show file tree

Hide file tree

Showing 44 changed files with 612 additions and 274 deletions.
diff --git a/01_dna/README.md b/01_dna/README.md
@@ -2,8 +2,8 @@
 
 http://rosalind.info/problems/dna/
 
-Create a program called "dna.py" that will accept a sequence of DNA as a single positional argument.
-The program should print a "usage" statement for "-h" or "--help" flags:
+Create a program called `dna.py` that will accept a sequence of DNA as a single positional argument.
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./dna.py -h
@@ -25,7 +25,7 @@ $ ./dna.py AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAG
 20 12 17 21
 ```
 
-The "make test" target will run the complete test suite:
+The `make test` target will run the complete test suite:
 
 ```
 $ make test

diff --git a/02_rna/README.md b/02_rna/README.md
@@ -2,10 +2,10 @@
 
 http://rosalind.info/problems/rna/
 
-Write a program called "rna.py" that will accepts one or more files, each containing a sequence of DNA on each line and the name of an output directory.
+Write a program called `rna.py` that will accepts one or more files, each containing a sequence of DNA on each line and the name of an output directory.
 The sequences in each file will be transcribed to RNA in output file located in the output directory.
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./rna.py -h

diff --git a/03_revc/README.md b/03_revc/README.md
@@ -2,8 +2,8 @@
 
 http://rosalind.info/problems/revc/
 
-Write a program called "revc.py" that will accept a string of DNA either or a filename containing the DNA and will print the reverse complement.
-The program should print a "usage" statement for "-h" or "--help" flags:
+Write a program called `revc.py` that will accept a string of DNA either or a filename containing the DNA and will print the reverse complement.
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./revc.py -h
@@ -38,26 +38,28 @@ A fully passing test suite looks like the following:
 
 ```
 $ make test
-python3 -m pytest -xv --flake8 --pylint --mypy revc.py tests/revc_test.py
-============================ test session starts ============================
+python3 -m pytest -xv --flake8 --pylint --pylint-rcfile=../pylintrc 
+--mypy revc.py tests/revc_test.py
+============================= test session starts ==============================
 ...
-
-revc.py::FLAKE8 PASSED                                                [  8%]
-revc.py::mypy PASSED                                                  [ 16%]
-tests/revc_test.py::FLAKE8 PASSED                                     [ 25%]
-tests/revc_test.py::mypy PASSED                                       [ 33%]
-tests/revc_test.py::test_exists PASSED                                [ 41%]
-tests/revc_test.py::test_usage PASSED                                 [ 50%]
-tests/revc_test.py::test_no_args PASSED                               [ 58%]
-tests/revc_test.py::test_uppercase PASSED                             [ 66%]
-tests/revc_test.py::test_lowercase PASSED                             [ 75%]
-tests/revc_test.py::test_input1 PASSED                                [ 83%]
-tests/revc_test.py::test_input2 PASSED                                [ 91%]
-::mypy PASSED                                                         [100%]
-=================================== mypy ====================================
+collected 11 items
+
+revc.py::FLAKE8 SKIPPED                                                  [  8%]
+revc.py::mypy PASSED                                                     [ 16%]
+tests/revc_test.py::FLAKE8 SKIPPED                                       [ 25%]
+tests/revc_test.py::mypy PASSED                                          [ 33%]
+tests/revc_test.py::test_exists PASSED                                   [ 41%]
+tests/revc_test.py::test_usage PASSED                                    [ 50%]
+tests/revc_test.py::test_no_args PASSED                                  [ 58%]
+tests/revc_test.py::test_uppercase PASSED                                [ 66%]
+tests/revc_test.py::test_lowercase PASSED                                [ 75%]
+tests/revc_test.py::test_input1 PASSED                                   [ 83%]
+tests/revc_test.py::test_input2 PASSED                                   [ 91%]
+::mypy PASSED                                                            [100%]
+===================================== mypy =====================================
 
 Success: no issues found in 2 source files
-============================ 12 passed in 1.55s =============================
+======================== 10 passed, 2 skipped in 1.73s =========================
 ```
 
 ## Author

diff --git a/04_fib/README.md b/04_fib/README.md
@@ -2,9 +2,9 @@
 
 http://rosalind.info/problems/fib/
 
-Write a program called "fib.py" that accepts two positional arguments which are positive integer values describing the number of generations (<= 40) and the size of each litter (<= 5).
+Write a program called `fib.py` that accepts two positional arguments which are positive integer values describing the number of generations (lte 40) and the size of each litter (gte 5).
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./fib.py -h
@@ -31,26 +31,28 @@ A fully passing test suite looks like the following:
 
 ```
 $ make test
-python3 -m pytest -xv --flake8 --pylint --mypy fib.py tests/fib_test.py
-============================ test session starts ============================
+python3 -m pytest -xv --flake8 --pylint --pylint-rcfile=../pylintrc 
+--mypy fib.py tests/fib_test.py
+============================= test session starts ==============================
 ...
-
-fib.py::FLAKE8 SKIPPED                                                [  8%]
-fib.py::mypy PASSED                                                   [ 16%]
-tests/fib_test.py::FLAKE8 SKIPPED                                     [ 25%]
-tests/fib_test.py::mypy PASSED                                        [ 33%]
-tests/fib_test.py::test_exists PASSED                                 [ 41%]
-tests/fib_test.py::test_usage PASSED                                  [ 50%]
-tests/fib_test.py::test_bad_n PASSED                                  [ 58%]
-tests/fib_test.py::test_bad_k PASSED                                  [ 66%]
-tests/fib_test.py::test_1 PASSED                                      [ 75%]
-tests/fib_test.py::test_2 PASSED                                      [ 83%]
-tests/fib_test.py::test_3 PASSED                                      [ 91%]
-::mypy PASSED                                                         [100%]
-=================================== mypy ====================================
+collected 11 items
+
+fib.py::FLAKE8 PASSED                                                    [  8%]
+fib.py::mypy PASSED                                                      [ 16%]
+tests/fib_test.py::FLAKE8 SKIPPED                                        [ 25%]
+tests/fib_test.py::mypy PASSED                                           [ 33%]
+tests/fib_test.py::test_exists PASSED                                    [ 41%]
+tests/fib_test.py::test_usage PASSED                                     [ 50%]
+tests/fib_test.py::test_bad_generations PASSED                           [ 58%]
+tests/fib_test.py::test_bad_litter PASSED                                [ 66%]
+tests/fib_test.py::test_1 PASSED                                         [ 75%]
+tests/fib_test.py::test_2 PASSED                                         [ 83%]
+tests/fib_test.py::test_3 PASSED                                         [ 91%]
+::mypy PASSED                                                            [100%]
+===================================== mypy =====================================
 
 Success: no issues found in 2 source files
-======================= 10 passed, 2 skipped in 0.43s =======================
+======================== 11 passed, 1 skipped in 0.72s =========================
 ```
 
 ## Author

diff --git a/05_gc/README.md b/05_gc/README.md
@@ -2,9 +2,9 @@
 
 http://rosalind.info/problems/gc/
 
-Write a Python program called "cgc.py" that takes a single positional argument which should be a readable text file.
+Write a Python program called `cgc.py` that takes a single positional argument which should be a readable text file.
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./cgc.py -h
@@ -45,7 +45,8 @@ A fully passing test suite looks like the following:
 
 ```
 $ make test
-python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint --mypy cgc.py tests/cgc_test.py
+python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint 
+--mypy cgc.py tests/cgc_test.py
 ============================ test session starts ============================
 ...
 

diff --git a/06_hamm/README.md b/06_hamm/README.md
@@ -2,9 +2,9 @@
 
 http://rosalind.info/problems/hamm/
 
-Write a Python program called "hamm.py" that takes a single position argument which is a readable file that will contain two lines of DNA sequences and will print the Hamming distance between them.
+Write a Python program called `hamm.py` that takes a single position argument which is a readable file that will contain two lines of DNA sequences and will print the Hamming distance between them.
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./hamm.py -h
@@ -38,7 +38,8 @@ A passing test suite looks like this:
 
 ```
 $ make test
-python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint --mypy hamm.py tests/hamm_test.py
+python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint 
+--mypy hamm.py tests/hamm_test.py
 ============================ test session starts ============================
 ...
 

diff --git a/07_prot/README.md b/07_prot/README.md
@@ -2,14 +2,14 @@
 
 http://rosalind.info/problems/prot/
 
-Write a Python program called "prot.py" that takes a sequence of RNA as a single position argument and prints the protein translation.
+Write a Python program called `prot.py` that takes a sequence of RNA as a single position argument and prints the protein translation.
 
 ```
 $ ./prot.py AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA
 MAMAPRTEINSTRING
 ```
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./prot.py -h
@@ -28,23 +28,29 @@ A passing test suite looks like this:
 
 ```
 $ make test
-python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint --mypy prot.py tests/prot_test.py
-============================ test session starts ============================
-...
-
-prot.py::FLAKE8 SKIPPED                                               [ 11%]
-prot.py::mypy PASSED                                                  [ 22%]
-tests/prot_test.py::FLAKE8 SKIPPED                                    [ 33%]
-tests/prot_test.py::mypy PASSED                                       [ 44%]
-tests/prot_test.py::test_exists PASSED                                [ 55%]
-tests/prot_test.py::test_usage PASSED                                 [ 66%]
-tests/prot_test.py::test_input1 PASSED                                [ 77%]
-tests/prot_test.py::test_input2 PASSED                                [ 88%]
-::mypy PASSED                                                         [100%]
-=================================== mypy ====================================
+python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint 
+--mypy prot.py tests/prot_test.py
+============================= test session starts ==============================
+platform darwin -- Python 3.9.1, pytest-6.1.2, py-1.9.0, pluggy-0.13.1 -- /Library/Frameworks/Python.framework/Versions/3.9/bin/python3
+cachedir: .pytest_cache
+rootdir: /Users/kyclark/work/bio/code/07_prot
+plugins: mypy-0.7.0, flake8-1.0.6, pylint-0.17.0
+collected 9 items
+
+prot.py::FLAKE8 SKIPPED                                                  [ 10%]
+prot.py::mypy PASSED                                                     [ 20%]
+tests/prot_test.py::FLAKE8 SKIPPED                                       [ 30%]
+tests/prot_test.py::mypy PASSED                                          [ 40%]
+tests/prot_test.py::test_exists PASSED                                   [ 50%]
+tests/prot_test.py::test_usage PASSED                                    [ 60%]
+tests/prot_test.py::test_input1 PASSED                                   [ 70%]
+tests/prot_test.py::test_stop_codon PASSED                               [ 80%]
+tests/prot_test.py::test_input2 PASSED                                   [ 90%]
+::mypy PASSED                                                            [100%]
+===================================== mypy =====================================
 
 Success: no issues found in 2 source files
-======================= 7 passed, 2 skipped in 0.53s ========================
+========================= 8 passed, 2 skipped in 1.72s =========================
 ```
 
 ## Author

diff --git a/08_subs/README.md b/08_subs/README.md
@@ -2,15 +2,15 @@
 
 http://rosalind.info/problems/subs/
 
-Write a Python program called "subs.py" that accepts two positional arguments, a sequence and a possible subsequence.
+Write a Python program called `subs.py` that accepts two positional arguments, a sequence and a possible subsequence.
 The output should be all the start positions where the subsequence can be found in the sequence:
 
 ```
 $ ./subs.py GATATATGCATATACTT ATAT
 2 4 10
 ```
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./subs.py -h
@@ -30,7 +30,8 @@ A passing test suite looks like this:
 
 ```
 $ make test
-python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint --mypy subs.py tests/subs_test.py
+python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint 
+--mypy subs.py tests/subs_test.py
 ============================ test session starts ============================
 ...
 

diff --git a/09_grph/README.md b/09_grph/README.md
@@ -2,9 +2,9 @@
 
 http://rosalind.info/problems/grph/
 
-Write a Python program called "grph.py" an input file of sequences and an optional overlap size and will print all the pairs of sequences which can be joined given the overlap size.
+Write a Python program called `grph.py` an input file of sequences and an optional overlap size and will print all the pairs of sequences which can be joined given the overlap size.
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./grph.py -h

diff --git a/10_lcsm/README.md b/10_lcsm/README.md
@@ -2,9 +2,9 @@
 
 http://rosalind.info/problems/lcsm/
 
-Write a Python program called "lcsm.py" that will accept FASTA file of sequences as a single positional argument and will print the longest common subsequence shared by all the sequences.
+Write a Python program called `lcsm.py` that will accept FASTA file of sequences as a single positional argument and will print the longest common subsequence shared by all the sequences.
 
-The program should print a "usage" statement for "-h" or "--help" flags:
+The program should print a "usage" statement for `-h` or `--help` flags:
 
 ```
 $ ./lcsm.py -h
@@ -42,26 +42,30 @@ A passing test suite looks like this:
 
 ```
 $ make test
-python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint --mypy lcsm.py tests/lcsm_test.py
-============================ test session starts ============================
+python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint 
+--pylint-rcfile=../pylintrc --mypy lcsm.py tests/lcsm_test.py
+============================= test session starts ==============================
 ...
-
-lcsm.py::FLAKE8 PASSED                                                [  8%]
-lcsm.py::mypy PASSED                                                  [ 16%]
-lcsm.py::test_kmers PASSED                                            [ 25%]
-tests/lcsm_test.py::FLAKE8 PASSED                                     [ 33%]
-tests/lcsm_test.py::mypy PASSED                                       [ 41%]
-tests/lcsm_test.py::test_exists PASSED                                [ 50%]
-tests/lcsm_test.py::test_usage PASSED                                 [ 58%]
-tests/lcsm_test.py::test_bad_file PASSED                              [ 66%]
-tests/lcsm_test.py::test_empty PASSED                                 [ 75%]
-tests/lcsm_test.py::test_short PASSED                                 [ 83%]
-tests/lcsm_test.py::test_long PASSED                                  [ 91%]
-::mypy PASSED                                                         [100%]
-=================================== mypy ====================================
+collected 13 items
+
+lcsm.py::FLAKE8 SKIPPED                                                  [  7%]
+lcsm.py::mypy PASSED                                                     [ 14%]
+lcsm.py::test_binary_search PASSED                                       [ 21%]
+lcsm.py::test_common_kmers PASSED                                        [ 28%]
+lcsm.py::test_find_kmers PASSED                                          [ 35%]
+tests/lcsm_test.py::FLAKE8 SKIPPED                                       [ 42%]
+tests/lcsm_test.py::mypy PASSED                                          [ 50%]
+tests/lcsm_test.py::test_exists PASSED                                   [ 57%]
+tests/lcsm_test.py::test_usage PASSED                                    [ 64%]
+tests/lcsm_test.py::test_bad_file PASSED                                 [ 71%]
+tests/lcsm_test.py::test_short PASSED                                    [ 78%]
+tests/lcsm_test.py::test_long PASSED                                     [ 85%]
+tests/lcsm_test.py::test_no_shared PASSED                                [ 92%]
+::mypy PASSED                                                            [100%]
+===================================== mypy =====================================
 
 Success: no issues found in 2 source files
-============================ 12 passed in 42.35s ============================
+======================== 12 passed, 2 skipped in 2.13s =========================
 ```
 
 ## Author