using html

docs/index.html

@@ -0,0 +1,99 @@
+MassBLAST
+==========
+
+Perform BLAST queries from multiple files against different databases at once.
+
+## Install
+
+The latest release can be [downloaded here](https://github.com/averissimo/mass-blast/releases/latest).
+
+It already has most dependencies, **it only requires BLAST+ to be installed before running**: [link to download latest version](https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&DOC_TYPE=Download)
+
+Important note for Windows users:
+  1. Can only install 32-bit version of BLSAT+ (latest win32 version is 2.2.30 that can be [downloaded here](ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/))
+  2. If it gives an error, please delete `ncbi.ini` located at a subdirectory at the `AppData` folder, if problem persists, submit an issue.
+
+### How to use it?
+
+Options can be configurable at `user.yml`, check `user.yml.example` for more information.
+
+- Place fasta files with queries at `db_and_queries/queries` folder.
+  - You can have as many files as needed, see below for an example of a nucleotide query
+- Place blast databases at `db_and_queries/db` folder.
+  - Check "How to setup a Blast database for a transcriptome" below for more information on creating a Blast database.
+- Edit user.yml file to change options and BLAST engine to be used.
+- run mass-blast script *(either double click it on Windows or as a command in the command line.*
+
+Example of a nucleotide query file that could be placed in `db_and_queries/queries` folder:
+
+```
+>Example01
+attgggaatttactgcaactcaaggagaagaaaccctaccagacttttacaaggtgggct
+gaggagt
+>Example03
+attgggaatttactgcaactcaaggagaagaaaccctaccagactttt
+>Example02
+attgggaatttactgcaactcaaggagaagaaaccctaccagacttttacaaggtgggct
+gaggagtatttactgcaactcaaggagaagaaaccctaccagacttttacaaggtggtgg
+gcaactcaagcaactcaagcaactcaagcaactcaa
+```
+
+### Type of blast implemented
+
+- Blastn
+- TBlastn
+- TBlastx
+
+
+### How to setup a Blast database for a transcriptome
+
+Using makeblastdb command that comes bundled with Blast+
+
+- Open the command line in your operating system
+- Navigate to directory
+- Go to directory that has the fasta file with the assembly
+- Run makeblastdb command in that directory
+
+  - nucleotides database
+
+    $ makeblastdb -in <filename> -dbtype nucl -out "<blast_db_new_name>" -title "<blast_db_new_name>"
+
+  - protein database
+
+    $ makeblastdb -in <filename> -dbtype nucl -out "<blast_db_new_name>" -title "<blast_db_new_name>"
+
+*note:* do to not use spaces in the <blast db new name>
+
+#### Quickly setup databases
+
+Place the fasta files for the database in db_and_queries/import_dbs directory and run the appropriate script.
+
+You also need to say if it is a nucleotide or protein-based fasta file.
+
+For Linux and Mac OS X run the `import_fastas.sh` script
+
+    $ cd db_and_queries/import_dbs
+    # for nucleotide
+    $ sh import_fastas.sh nucl
+    # for protein
+    $ sh import_fastas.sh prot
+
+For Windows run the `import_fastas.bat` script
+
+    $ cd db_and_queries/import_dbs
+    # for nucleotide
+    $ import_fastas.bat nucl
+    # for protein
+    $ import_fastas.bat prot
+
+### Relation with other tools
+
+- [Gene Extractor](https://github.com/averissimo/gene-extractor/): can be used to extract genes from Kegg2 and GenBank using keyword search.
+- [ORF-Finder](http://github.com/averissimo/orf_finder): Finds the longest Open Reading Frame from a nucleotide sequence.
+- [MassBlast package bundler](https://github.com/averissimo/app-mass-blast): Creates a package that can be easily used in all main Operating Systems without having to install Ruby and any Ruby dependecies.
+
+## Ackowledgements
+
+This tool was created as a part of [FCT](www.fct.p) grant SFRH/BD/97415/2013 and European Commission research project [BacHBerry](www.bachberry.eu) (FP7- 613793)
+
+[Developer](http://web.tecnico.ulisboa.pt/andre.verissimo/)