We developed it based on the Lindel documentation (https://lindel.gs.washington.edu/Lindel/docs/). This Rshiny application should have the same results as Lindel. The input sequence also need to follow the introduction on the Lindel documentation: " It takes 65 bp sequence ( cleavage site at 30) as an input and predicts the frequencies for all possible deletions <30 bp, all 1-2 bp insertions, and insertions larger than 2 bp as a group."
- command line install
- pwd: /Users/Hui/CRISPRLindel
Compatible with both Python2.7 and Python3.5 or higher.
-
create conda env: conda create -y --name r-cl python=3.6
-
conda info active environment : r-cl active env location : /Users/hui/opt/anaconda3/envs/r-cl shell level : 3 user config file : /Users/Hui/.condarc populated config files : /Users/Hui/.condarc conda version : 4.8.3 conda-build version : 3.18.11 python version : 3.7.6.final.0
-
which conda: conda = "/Users/hui/opt/anaconda3/condabin/conda"
-
conda install : Requires biopython,numpy and scipy
-
Lidel install git clone https://github.com/shendurelab/Lindel.git cd Lindel python setup.py install python Lindel_prediction.py TAACGTTATCAACGCCTATATTAAAGCGACCGTCGGTTGAACTGCGTGGATCAATGCGTC test_seq
- working in Rstudio
-
prepare enviroment library(reticulate) Python conda
-
R_Lindel_prediction Define rlindel function based on Lindel_prediction.py, with only one argument: inputseq, return the indels.
source_python("RLindelprediction.py") RLindelprediction.py was modificated based on Lindel_prediction.py with the following changes: add write_file define rlp (r_lindel_prediction) function. Replace sys.argv[1] with fucntion parameter inputseq. Drop filename = sys.argv[2] Replace print with return
- Rshiny an example sequence ( the same one as Lindel documentation "TAACGTTATCAACGCCTATATTAAAGCGACCGTCGGTTGAACTGCGTGGATCAATGCGTC") can also be downloaded as a CSV file by clicking the download button.
- install CRISPRseek BiocManager::install("CRISPRseek") browseVignettes("CRISPRseek")