Split Fasta is a command-line tool which allows you to split the Fasta file with multiple sequences into individual Fasta files.
You can install Split Fasta from PyPI:
pip install split-fasta
The Split Fasta works with Python 3.6 & above.
The Split Fasta is a command-line tool, named splitfasta. To start it you have to go to the folder containing the Fasta file and then use the following syntax:-
splitfasta filename.fasta
And it will split the combined Fasta file into individual files and save it into filename_split_files directory with names from filename_1 to filename_n.
It accepts only .fasta and .fa files where each sequence is separated by '>'
The example input file is :-
>ID-1
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
>ID-2
ATGGCTCGAGCACCCGAGGAAGTCGAAGGCGGAGCCCAAGAAGAAGCTCCACCCCTCGCACGAGGCGGTGTTCGAACGCT
You can check out the detailed tutorial here
© 2020 Udit Vashisht
This repository is licensed under the MIT license. See LICENSE for details.